poprocksyum
poprocksyum poprocksyum
  • 24-01-2022
  • History
contestada

what is the formal and informal qualifications for U.S senate ​

Respuesta :

snowfallsnowfall179
snowfallsnowfall179 snowfallsnowfall179
  • 24-01-2022

Answer:

Formal qualifications: 25 years old, have been a citizen of the US for at least 7 years, and be an inhabitant of the state which they are elected.

Informal qualifications: party identification, name familiarity, gender, ethnic characteristics, and political experience

Answer Link

Otras preguntas

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
What might fire represent with relation to John Thornton in Chapters 6 and 7? Minimum 3 sentences. PLEASE HELPPP
a ÷ 9 = 81 What must I do to both sides to solve for ¨a¨
easy question Solve the proportion x/16 = 10/36 (round to the hundredths place)
is Jesus real? i'm so confused even though i am a Christian, i still don't believe that jesus is real
Allison is trying to decide whom to vote for in the coming congressional election. She believes strongly in labor unions and ingovernment regulation of business
Read the following excerpt from "Ellis Island" by Barbara Davis-Pyle. Then I smiled because all of the questions were over. The men asked Papa and Mama to read
Which molecule is a source of energy, a store of energy, and can mix with water?
A trait can also be called a/an
3. The Human Resources department of a large corporation wants to estimate the mean numberof unused vacation days that its employees have. They conduct a random