helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Please help me - - - Thanks by the way!!
I will give brainly!!!! The number 1,000, written using scientific notation, would be which of the following? Choose 1 answer: (Choice A) A 10^1 (Choice B) B 1
find the distance between the two given points H(-3,6) and C(-3,-3)
On January 3, 2018, Roberts Company purchased 30% of the 100,000 shares of common stock of Thomas Corporation, paying $1,500,000. There was no goodwill or other
ELA What is an interpretation? (5 points)
How, and why, did the French and Indian War start in North America?
Write two adjectives or descriptive phrases that describe the term, person, or event. 1. charter
Verbos de Bota 1 Spanish 3 Honors
HELP ASAP PLEASE What are some positive effects of the “Colombian Exchange”
Does the size of a substance affect its properties?