3893085 3893085
  • 25-01-2024
  • Mathematics
contestada

Use partial quotients to divide.
Question 2
Find the quotient.
$1,832\div32=$
R

Respuesta :

alizagarza107
alizagarza107 alizagarza107
  • 25-01-2024

57.25? Might be since by just simple dividing

Answer Link

Otras preguntas

A new energy drink advertises 100 calories for 5oz. How many calories are in 15oz of the drink?
Using the sinking fund approach, how much do you have to save each month to buy a $4,800 car one year from now?.
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Jaxson drove 4 miles in 1/15of an hour. If he drove at a constant rate, how far did he travel in one hour?
a letter to your friend who was not able to come to your birthday party telling him what happened at the party​
Mass and weight are different.mass depends on………., And weight depends on…………
Please help, the question is; Complete the sentence below by writing a fraction (in its simplest form). 1/7 is half of
Who was the presiding officer over the constitutional convention?.
Can someone PLEASE help?? asap
How do you do this to this problem