27-04-2017
Mathematics

contestada

Can I get some help ? It's confusing ://

Can I get some help Its confusing class=

Respuesta :

Аноним Аноним

07-05-2017

To find the answer you have to multiply 5.1 and 5.95 and divide it by two and multiply it by four because there are 4 triangles. After you multiply 5.1 and 5.95 to find the square. Then add up all the areas of the faces that you calculated. Also, you could look it up on Google...

Answer Link

Otras preguntas

A protein that contains more isoleucine, phenylalanine and leucine than asparagine, lysine and arginine is most likely ________. A protein that contains more is

The Alford Group had 260,000 shares of common stock outstanding at January 1, 2021. The following activities affected common shares during the year. There are n

How is radioactive dating important for providing evidence for evolution? O A. It tells you how many offspring an animal had. O B. It tells you when the animal

how did the actions of europenans affect the native americans

A civil service exam yields scores with a mean of 81 and a standard deviation of 5.5. Using Chebyshev's Theorem what can we say about the percentage of scores t

for a client diagnosed with end stage kidney disease and obsessive-compulsive disorder in the long-term care facility. The client has difficulty getting to dial

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

When considering special needs acceptance guidelines, which of the following is NOT included? A. A "one-size fits all" approach should be maintained. B. Need-ba

According to the Internal Revenue Service, the average length of time for an individual to complete (keep records for, learn, prepare, copy, assemble, and send)

Which pair of the following tests is used to test for normality? a. An Empirical cumulative distribution function test and an F-test b. A Quantile-Quantile plo