Seudónimo Seudónimo
  • 23-03-2017
  • Mathematics
contestada

order. from least to greastest 1/2 ,1/3 ,1/4

Respuesta :

SoccerGirl920
SoccerGirl920 SoccerGirl920
  • 23-03-2017
From least to greatest the fractions are 1/4 then 1/3 then 1/2.
Hope this helps!
Answer Link
Аноним Аноним
  • 23-03-2017
1/4,1/3 and 1/2 is the order from least to greatest

                                                                  
Answer Link

Otras preguntas

What the the equation -984-n=-285 what does n equal
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
. Slope intercept for y minus 3x equals 19
what are the 3 care instructions for future life on earth
approximately how long does it take the moon to complete one orbit around earth
Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell
Which name does the monk who travels to the west not use
what are examples of processing large data using web technologies
specificity is important to fitness program because it
Who owned the land that is now Florida before it became part of the United States? A. France B. Great Britain C. Spain D. Mexico