Steph4annsraitlylor Steph4annsraitlylor

26-02-2017
Arts

contestada

The store ordered small posters and large posters to promote their opening. 12 times as many small were ordered as large posters. if there were 48 large posters how many more small posters were ordered than large posters.

Respuesta :

dogsrdabest dogsrdabest

26-02-2017

48 times 12= 576
576-48= 528
528 more small posters

Answer Link

Otras preguntas

organelle in plants that uses light energy to make glucose in a process called _____.

Mandy i an engineer at an oxygen tank upply company. She conducted an experiment to find poible tank ize. The maximum preure in the tank cannot be more than 300

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

consider the cantilevered w14×30 beam shown in (figure 1) . e = 29(10^3) ksi, i = 291 in^4. (a) Determine the expression for the elastic curve using the coordin

if a set of instructions that determines all of the characteristics of an organism is compared to a book, and a chromosome is compared to a chapter in the book,

Baby timothy suffers from apnea and is hooked up to a monitor to warn his parents when he stops breathing. timothy's dad snores very loudly. timothy's condition

ten distinct points are chosen on a circle. a line segment is drawn between every pair of chosen points. how many line segments are drawn?

2 A normal die, numbered 1 to 6, is rolled 50 times. The results are shown in the frequency table. Score Frequency (b) Find the median score. (a) Write down the

The professor asks his class for three volunteers to help him box up books. everyone is silent, and katcha looks around the room to see if anyone is going to vo

When an experiment gets similar results through repeated trials, it is said to be what?.