FinneganS267428 FinneganS267428
  • 25-10-2022
  • Mathematics
contestada

Solve the inequality X - (5 - 3x) = 2x - 1

Respuesta :

AvaelizabethJ98003 AvaelizabethJ98003
  • 25-10-2022

hi,

x - (5 - 3x) = 2x - 1

x - 5 + 3x = 2x - 1

x - 2x + 3x = -1 + 5

2x = 4

x = 4/2

x =< 2

[tex]\text{ x }\leq\text{ 2}[/tex]

The result is letter A, the first choice

Answer Link

Otras preguntas

What else must you know to prove the triangles congruent by ASA? The image is of a parallelogram ABCD with diagonal AC. Angle DAC and ACB are marked as equal.
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Who controlled most of Central Asia until the early 1990s? the Soviet Union Saudi Arabia Afghanistan China
Sophia has asked her mom to pick her up at soccer practice. However, her mom doesn’t show up until half an hour after practice is over. Sophia is angry. Write a
On a coordinate plane titled area of maya's poster, a curved line with a minimum value of (1, negative 1) crosses the x-axis at (0, 0) and (2, 0), and the y-axi
plz helppp!!!!! I NEED IT NOWW !!!!!!!!!!!!!!!!
What is the NADPH responsible for?
What is 50 million + 32 hundred thousands + 41 hundred
Make x the subject of the formula: y=x^{2} + 5
I want the definitions for each one! 1. Demand 2. Industrial 3. Population 4. Rural 5. Urban 6. Agriculture 7. Economy 8. Revolution 9. Social Class 10. Trade R