miguel2124 miguel2124

21-07-2022
Mathematics

contestada

The inequality |2x - 5 > 8 can be written as which two inequalities?

Respuesta :

mathstudent55 mathstudent55

21-07-2022

Answer:

2x - 5 < -8 or 2x - 5 > 8

Step-by-step explanation:

|2x - 5| > 8

2x - 5 < -8 or 2x - 5 > 8

Answer Link

Otras preguntas

calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm

Is sextillion a real number?

Work out the Hcf of 32 and 36

Your grandma thinks that the theory of evolution can't be possible because she has never seen a monkey turn into a human. How could you convince her otherwise?

Find the commission on a $750.00 sale if the commission is 24%. $166.00 $180.00 $131.25 $201.00

write a formula that relates the are A of a triangle to to the lengths of its base b and height h

Describe the fluid theory of intelligence; then explain your views on the theory

Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Suggest a reason why food labels provide information about the energy released by the food?