26-04-2022
Social Studies

contestada

which one is the smile help i too lazy to do this even know I can

which one is the smile help i too lazy to do this even know I can class=

Respuesta :

26-04-2022

Answer:

The answer is B.

Explanation:

a simile is a sentence using like or as.

Answer Link

27bedgerly 27bedgerly

04-05-2022

Answer:

I think it is D. My Dog eats a ton of food each day

Explanation:

i know im right

Answer Link

Otras preguntas

Three words that can describe irregular line are

What is the radius of a circle that has an approximate circumference of 43.96 feet?

Compare the maps. Which state listed below was located in the Great Basin Native American cultural region?

SICL4 + H2O sio2 hcl

explain how the physical characteristics of an aquatic habitat determine the presence or absence of organisms.

a restaurant added some new items to their menu. Of the 45 people that tried the new items, 43 said they liked the changes. If the restauant had 315 customers o

DNA tacaggtacccgaacccaattta

Barry's mountain bike weighs 6 pounds more than Andy's if their bikes weigh 42 pounds together, How much does Barry's bike weigh

Identify and explain some of the basic premises of carpe diem poetry, then discuss how Raleigh’s “The Nymph’s Reply” answers these premises. Your answer should

A square tile has a width of 1/4 foot.How many tiles will fit end-to-end along a 4- foot tiles