allenramiah3 allenramiah3

22-03-2022
Mathematics

contestada

How would the following triangle be classified

How would the following triangle be classified class=

Respuesta :

26leratocervantes 26leratocervantes

22-03-2022

Answer:

C i think... sorry if im wrong

Step-by-step explanation:

Answer Link

Otras preguntas

6x+2y=-2 3x−2y=-5 algebra 8 combining equations

(EXPLAIN) A chicken farm sold 59 cartons of eggs, each containing 12 eggs. Round to the nearest ten to estimate the total number of eggs sold.

Use the information given to answer the question. A factory makes rugs at a constant rate of 10 rugs every 4 hours. Part A How long does it take the factory to

is it important to challenge unfair rules, even if doing so gets you in trouble? you can use stories, movies or real events

Write in exponential notation

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

how many miles is 65 yards

How did many northerners respond to the Fugitive Slave Act? What concerns did northerners have slavery in the 1850's?

Megan has 5/6 of a box of raisins. she gave 1/2 of those raisins to her friend. Megan says she gave 2/6 of the box of raisins to her friend. what is Megan's mis

Who has the power to admit new states to the United States? Congress Governor Federal judge Vice president