mideonsembrace7904 mideonsembrace7904

24-01-2022
Mathematics

contestada

jada has read 2/5 of a book. She reead 76 pages so far

Respuesta :

GlitterlingGigi GlitterlingGigi

24-01-2022

Answer:

125

Step-by-step explanation:

The total number of pages she read is 125.

Answer Link

Otras preguntas

Janet ate breakfast at a restaurant. The bill came to $28. If she left a 15% tip, how much was the tip? $

Algebra 1 > 1.1 Is (x, y) a solution to the system of equations? LRL Is (1, 3) a solution to this system of equations? 3x + 5y = 18 17x + y = 20 yes no Submi

How and why did the African American community in the South work towards civil right?

Answer choices 8 6 10 Please help and don’t give me a link cause I’m Not falling for it

Why do you think there is a limit on the number of times you can withdraw or transfer money in your savings account?

Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands

how much is 4^7 + 4^7 ÷ 4^5?

What value of 'k' makes the equation 3k-4=20 true? Explain how you know.

“Then it will get washed this evening,” said the large woman starting up the street, (dragging) the frightened boy behind her. (Read this and tell me how the la

istribute and simplify these radicals square root 12 times (-1+ square root 5)