derrickswidt derrickswidt
  • 24-01-2022
  • History
contestada

Help please I’ll mark Brainly

Help please Ill mark Brainly class=

Respuesta :

140130561 140130561
  • 24-01-2022

Answer: i thank 2 and 4

Explanation:

i'm sorry if i am wrong

Answer Link

Otras preguntas

in response to the deep economic downturn in the us in 2008 and 2009, the us group of answer choices reduced taxes. increased government spending. all of the ab
An 18-year-old football player is seen in the emergency ward with severe knee pain incurred after being hit by a tackler while running. Which of the followingfi
My clamate enjoy_____che at break time o much A. To playing B. To play C. Playing D. Play
Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul
from a marketing viewpoint, price is _____ exchanged for the ownership or use of a good or service.
Paying people more when they contribute more increases motivation, which in turn leads to high performance. TRUE/FALSE
According to lecture what was the (Latin) name of the structure in the following image? (square structure with a main room with steps and an altar)
a conditional probability p(b|a) is equal to its marginal probability p(b) if
7)a and b are walking on straight streets that meet at right angles. a approaches the intersection at 2m/sec; b moves away from the intersection at 1m/sec. at w
refer to figure 3-2. a decrease in the price of the product would be represented by a movement from