gigimontanino5 gigimontanino5
  • 25-09-2021
  • Biology
contestada

What is the addition of mass called

Respuesta :

yousafzaikhaistagul
yousafzaikhaistagul yousafzaikhaistagul
  • 06-10-2021

While adding we need to follow that the units of mass i.e., kilogram and gram are converted into grams before addition and then follow the simple addition process. We can add two or more units of mass given in kilogram and grams like ordinary numbers. Always express grams as 3-digit numbers for example 3 g = 003 g.

Answer Link

Otras preguntas

Work out the Hcf of 32 and 36
What is double consciousness
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?
how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?
if if x+y=10, find the value of y when x=3
Sam left his school at 3:05. He walked at a speed of 3.2 mph. 15 minutes later, Al started running after him, and he caught up with Sam 10 minutes later. What w
how did Thomas Edison contribute to the Industrial Revolution
how were the 18th century French revolutionaries inspired by the enlightenment
Can someone help me with this problem... #20