kiyondinewton02
kiyondinewton02 kiyondinewton02
  • 22-08-2021
  • Chemistry
contestada

Please help me answer that question.

Please help me answer that question class=

Respuesta :

Аноним Аноним
  • 22-08-2021

Answer:

(I)

[tex] = (1 + 35.5) \\ = 36.5[/tex]

(II)

[tex] = \{1 + 14 +(16 \times 3) \} \\ = 63[/tex]

(III)

[tex] = \{(2 \times 39) + 12 + (16 \times 3) \} \\ = 138[/tex]

(IV)

[tex] = 23 + 16 + 1 \\ = 40[/tex]

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Bob sees a very tall white pine tree. He estimates that the angle of elevation from him to the top of the tree is 77° . He is 20 feet from the base of the tre
compare the following number :- ▪︎ 3 × 10¹² and 4 × 10¹¹ I need a well explained solution,pls not from any other websites thx for answering~~​
If f(x)= 5x, what is f^-1(x)?
Help help help math math
In documentary filmmaking, why is it typical for a filmmaker to write a script after the film is shot?
can someone help? No explanation needed :')
The Eager Mercutio""Who is the intended audience? Briefly explain why in at least two sentences.What is the author’s message? What sentences help support that m
Question 7 of 10 What are the three main parts to a slide presentation's structure? A. Thesis statement, supporting evidence, and concluding quotes B. Main idea
During development individual cells of the same organism begin to produce different proteins because.