dorrissackey dorrissackey

25-07-2021
Social Studies

contestada

Name the intermidiaries of
the compass

Respuesta :

maddie949395 maddie949395

25-07-2021

I think North east....

Answer Link

Otras preguntas

As a pendulum swings back and forth, its total energy is 16 J. What is its kinetic energy at 3/4 its maximum height? A. 4 B. 5

IM ON A TIMER! PLZZZ HELP Read the excerpt from Emily Dickinson’s “I’m Nobody! Who Are You?” Which two lines have a rhyming pattern? How dreary—to be—Somebo

How did Marco Polo impact relations between Europe and China

Las líneas de Nazca están en _____________________ (geographic region / form)

plz help and explain!!!1-2-3

sorry i'm 9 i was october the 27 2009 so im 9

Check my work? Graph y= -7/3x + 2

Solve the inequality |x − 6| − 10 < 1 Write the answer as a compound inequality Answers are; −5 > x > 17 −11 < x < 11 x < 17 −5

Help please!!!! !!!!!!!

DNA tacaggtacccgaacccaattta