darryl042008 darryl042008
  • 23-07-2021
  • Mathematics
contestada

Identify the domain of the graph given below.

Identify the domain of the graph given below class=

Respuesta :

loconte loconte
  • 23-07-2021

Answer:

(-∞,∞) is the domain.

2 is the range

Step-by-step explanation:

Answer Link

Otras preguntas

What is the difference between prokaryotic and eukaryotic DNA?
help with 2,3,4, and 5 please!!
a football team loses 5 yards on one and then loses 8 yard on the next play how many yards did they lose
f(x) = -3x + 1, find f(10)
the ph of a 0.04 M Calcium hydroxide is
The graphs below show measurements from cubes with different side lengths. A 24 8 Perimeter of 1 Face 16 12 4 40 36 32 828 1 3 Side Length 2 4 M Which pairs of
Determine the amount of heat (in joules) absorbed or released in each of the following changes.
write a equation for the situation please
A potential impact of prose written in third-person limited point of view could be a surprise ending. Is the statement true or false? True False
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I