trinidadidairy trinidadidairy

26-05-2021
Mathematics

contestada

△WXY is a right triangle, and △WZY is an isosceles triangle where WY¯¯¯¯¯¯≅ZY¯¯¯¯¯. Which is the measure of ∠XYZ?

Respuesta :

rodjeremiah007 rodjeremiah007

26-05-2021

Answer:

he base angles are congruent.

The two sides opposite the base angles are congruent.

The bisector of the vertex angle is the perpendicular bisector of the base.

Step-by-step explanation:

Answer Link

Otras preguntas

PLZZZZZZZ NEED HELP!!!!!!

SOMEONE PLEASE HELP ME! and also please explain how you solved this. thanks !! :)

The diameter of the circle is 59 centimeters. What is the approximate area of the circle

Lisa takes three tests. She gets scored of 85,82,and 91 what is her average

In terms of environmental economics, the only factions that disagree with each other are environmentalists and economists. True False

CD bisects AB at point G. If AE = BE, which equation must be true? A. BE = BG B. AE = 2(BG) C. AE = BG D. AG = BG E. none of these

jewelry is commonly weighted in carats. five carats are equivalent to one gram.how many grams are in 24-carat gold chain

Kylie has $500 to open a checking account. She wants an account with the lowest fees. She sometimes writes a check for more money than she has in her account. S

DNA tacaggtacccgaacccaattta

100+100(.15y)=150+150(.10y)