brudah81 brudah81
  • 26-04-2021
  • Mathematics
contestada

How can I find f?

Please help if you can!

How can I find f Please help if you can class=

Respuesta :

cede06 cede06
  • 26-04-2021
Okay so C is 55 and The other angle vertical from the 62 is also 62 so add those up and subtract from 180 you would get 63

63 is the answer
Answer Link
cryssybug
cryssybug cryssybug
  • 26-04-2021

Answer:

63°

Step-by-step explanation:

i=62° f+i=125° 125-62=63

Answer Link

Otras preguntas

Mice and Men: Why does George tell Slim that Lennie hurt Curley's wife?
A 7.8 kg outdoor copper sculpture heats up during the day from 28°C to 87°C. How much energy was absorbed? Note: Copper has a specific heat of 390 J/kg *C.
write an equation of a line that passes through each pair of points. (4,-8),(0,-2)
Design a research experiment. Write 1 paragraph (5-6 sentences) about your research. Answer the following questions: 1. What is the research question? 2. What i
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
La suma de dos números es 91 y están en la razón 4 : 3. Calcula el valor de cada número.
(y + 3) is always 5 more than (y-2) so (y + 3)-(y-2)=5 Complete the following. (y+4) − (y − 3) =
Find the value of x.
Please solve the perimeter (I know the answer, please explain steps)!!
please help!!!! give 100 points