Yoda12345678910 Yoda12345678910

24-04-2021
Physics

contestada

Can someone please help me with science.

Can someone please help me with science class=

Respuesta :

moliflower moliflower

24-04-2021

1 is b because a runs 20 and b rus 102 is c

Answer Link

Otras preguntas

Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !

Which process must occur before collection? A:precipitation B:condensation C:evaporation D:none of the above

Question 16 of 20 Select the best answer for the question. 16. Which of these federal policing agencies is part of the U.S. Department of the Treasury?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds

1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.

need help ASAP! A state park is designed in a circular pattern as shown. Mia runs along the circular path from the tennis courts to the petting zoo. How far doe

How can one concentrate in studies ?

I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi

What happens as genes are passed on from parent to offspring over many generations?