kolelohrke5 kolelohrke5
  • 21-04-2021
  • Biology
contestada

what does it mean if a micrograph is false colored?

what does it mean if a micrograph is false colored class=

Respuesta :

7thgradelol
7thgradelol 7thgradelol
  • 21-04-2021
A micrograph is "false-colored" because scientists often use computer techniques to add color in the colorless electrons to make certain structures stand out.
Answer Link

Otras preguntas

a rectangle has a width of 4 cm and a length of 8cm is scaled by a factor of 6.what are the side lengths of the scaled copy
The following graph predicts the time it takes to hike different distances. Which statements about the graph are true? (Choice A) A The point (0, 0)(0,0)left pa
Which is the same as 9/5?
How can a company distinguish between fully certified engineers and those who are not qualified?
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
i need help with C Spanish 3 Honors
During the summer after your first year at Carnegie Mellon, you are lucky enough to get a job making coffee at Starbucks, but you tell your parents and friends
Mr. Walker asked his students to use the associative property to find an expression that is equivalent to (13+15+20) + (20+47+18). The expressions that four stu
ANYONE KNOW ??? PICTURE ABOVE
What is the difference between a privilege and a right? 6 sentence paragraph