Jaxglauser4 Jaxglauser4
  • 22-03-2021
  • Health
contestada

The accepted way to eat caviar is to A. mix it with an equal part of mayonnaise and spread it on bread. B. spread it evenly over pasta or potatoes. C. place a small spoonful directly onto a toast wedge. D. place a small spoonful of caviar on your plate.

Respuesta :

Seikei
Seikei Seikei
  • 22-03-2021

Answer:

I think the best way to eat is caviar, sea urchin, with potato chips.

Answer Link

Otras preguntas

Solve for x help me please *****
help please ,,,,,,,,,
Why do you think we need to know about the Golden Age of the Islamic Civilization? How does it matter to you and the world?
A presidential veto is an example of which of the following?.
It takes 2 ½ spoons of chocolate to make ⅗ gallon of chocolate milk. How many spoons of chocolate would it take to make 1 gallon of chocolate milk?
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
What is an equation of the line that passes through the points (−3,8) and (-7, 8)
Answer the following for 10 points
Do you agree or disagree that the greeting of "Merry Christmas" could offend those who observe other holidays?​
what is 1,625 if you write it as a mathematical fraction?​