michaellall michaellall
  • 25-02-2021
  • Biology
contestada

Which of the following is an abiotic factor in the environment?

Respuesta :

yeliveg415 yeliveg415
  • 25-02-2021
An abiotic factor in a environment wind sunlight soil atmospher
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Whose image will replace Andrew Jackson on the U.S. 20$ bill
---------- is the ability to do an activity for more than a few minutes. What is the blank?
The price of a new car is 16000$ Mr Mar paid 15% of the price as a down payment how much does he still owe? (Please help and explain)
write a sentence using the words limiting factor and carrying capacity
What are the three differences between The Quran and the Gospel??
he percentage of children living in single-parent households in America’s five most populated cities is: Philadelphia 40.4%, New York, 30.5 %, Chicago 32.2%, Ho
This is Super Confusing to me
What does Holden have against bald men?
Allergies are the most common type of immune system disorder. Describe an allergic reacion and explain why it may be harmful. (5 marks)