saifahchowdhury608 saifahchowdhury608
  • 26-01-2021
  • Mathematics
contestada

Lowest common multiple of of 3,5,6

Respuesta :

Аноним Аноним
  • 26-01-2021

Answer:

30

hope it helps........

Answer Link
aypwil aypwil
  • 26-01-2021
answer
30
explanation
3,6,9,12,15,18,21,24,27,30
5,10,15,20,25,30
6,12,18,24,30
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga
Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell
(Does this represent a linear function) (3,6)(0,2)(3,5)
specificity is important to fitness program because it
What is the second Vatican council?
in millions of british pounds how much did germany spend in 1890
The deli scale weight meat and cheese in the hundredths of pound Sam put 5/10 pound of pepperoni in the deli scale what does the deli scale show
what other fields of the study might contribute to knowledge and understanding in art history?
the combined land area of the countries A and B is 147,973 square kilometers. Country A is larger by 673 square kilometers. Determine the land area of each coun