kazelvincent69 kazelvincent69
  • 25-01-2021
  • Mathematics
contestada

Which is the graph of y= x-3?

Which is the graph of y x3 class=

Respuesta :

bhawanapandab
bhawanapandab bhawanapandab
  • 25-01-2021

Answer:

Graph C

I'm pretty sure

Answer Link

Otras preguntas

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.
How do short-term goals differ from long-term goals?
Matt had to write 3 4/12 as an improper fraction right how you would tell Matt the easiest way to
Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle
Look At The Picture. Thats The Question I Need Answered ASAP
How do short-term goals differ from long-term goals?
The role of media on reporting human rights violation
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
why were mountain men moving west
Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.