jannadwhite4330 jannadwhite4330
  • 25-12-2020
  • Business
contestada

For companies that sell goods or services on account, if revenue is recognized prematurely, what would be overstated: sales or accounts receivable

Respuesta :

andromache andromache
  • 26-12-2020

Answer:

Both sales and account receivable

Explanation:

In the case when the company sells the goods or services on an account and the revenue is to be recorded prematurely so here the both accounts i.e. sales and the account receivable are overstated as it impacts these two accounts

Therefore the same is to be considered

hence, Both sales and account receivable are overstated

Answer Link

Otras preguntas

Which of the following is a problem with nuclear energy? It puts out air pollution. It runs on fossil fuels. Radiation leaks could harm the environment The fuel
What is the most significant intermolecular force acting between molecules of Ch3Cl
DNA tacaggtacccgaacccaattta
suppose a parabola has an axis of symmetry at x = -5, a maximum height of 9, and passes through the point (-7,1). write an equation of the parabola in vertex fr
describe Alice Paul's impact on the women suffrage movement.
Is the hacker group project zorgo real or fake yes
solve for z -c + 6z = tz +83
Find the slope of the line containing the pair of points? (-4,11) and (3,-6)
Though mercantilism limited trade during the Age of Exploration, European economies grew rapidly during this period, largely because of? A. The natural resourc
scrie un text de 4-5 randuri care sa contina ortogramele de-a dea si cam c-am