devoin devoin
  • 21-12-2020
  • English
contestada

who said, "This is not the Stone Ago. But it feels like we are going backward, Girls are getting more doprived of our rights"?

Respuesta :

eYUhs
eYUhs eYUhs
  • 21-12-2020

Answer:

Malala Yousafzai

Explanation:

Answer Link

Otras preguntas

What was John Locke's influence on American Democracy?​
A company's relevant range of production is 10,000 to 15,000 units. When it produces and sells 12,000 units, its unit costs are as follows: Amount per Unit Dire
Which of the following is the best example of a hierarchy?1. a set of siblings2. a classroom of students3. the court of a king4. the members of Congress​
SELECT ALL THAT APPLY. When reading a historical narrative, critical thinkers need to ask which of the following questions? a. Who is the story’s audience? b. W
LUZUJ ML) Monique's family is moving to a town where surfing is a popular sport. She has never surfed but is excited to learn. Monique's father suggested she pr
+3(2x + 1) « 2(5.3x)
An electronics store sends an email survey to all customers who bought tablets.
-4h + 1 = 33 What is h
What should be done to promote children's right ? (in points)
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?