trez4492 trez4492

23-11-2020
Mathematics

contestada

What is the slope of the line that contains the points -4,2 and 6,3

Respuesta :

23-11-2020

Answer:

1/10

Step-by-step explanation:

slope of a line is m

m=y2-y1/x2-x1 = 3-2/6-(-4)= 1/10

Answer Link

Otras preguntas

If there are 3 feet in 1 yard and 12 inches in 1 foot, how many inches are in 10 yards?

There is a bag filled with 3 blue, 4 red and 5 green marbles. A marble is taken at random from the bag, the colour is noted and then it is not replaced. Another

What are some subject areas PAS prepares students for? Select three options. Health science hospitality agricultural machinery information technology landscape

Is (1, 2) a solution to this system of equations? 3x + 8y = 19 x + 4y = 9 yes or no

please help !!! :(( How many grams are in 5.40 x 10^24 molecules of H₂O? How many grams of caffeine (C₈H₁₀N₄O₂) are found in 6.50x 10²² molecules? How many mole

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

Select True or False for each statement.

What is the rising action of the winter hibiscus

what is the outer surface of the earth

What would happen if American slaves heard of the Haitian Revolution? How would an American Slave revolt alter America today? How would the American economy be