angeledynwest angeledynwest

24-10-2020
Mathematics

contestada

[tex]\sqrt{54y^{11}z^{5} }[/tex]

Respuesta :

Pancaketheprotogen Pancaketheprotogen

24-10-2020

What, do you want that thing to be answered? There is a app that does your math for you in a few seconds i hope ya know. I dont think anyone here could figure that out either.

Answer Link

Otras preguntas

John Locke would have agreed with all of the following statements EXCEPT:

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Does old age means end of life according to A Tennyson in Ulysses

1+4=5 2+5=12 3+6=21 8+11=

Please help me answer these questions

What two cell types do complement proteins interact with, besides the pathogen itself?

---------- is the ability to do an activity for more than a few minutes. What is the blank?

statement and reasons m<1 +m<2+ m<3=180 whats the reason?

john bought a used truck for $4,500 he made an agreement with the dealer to put $1,500 down and mae payments of $350 for the next 10 months the extra cost paid

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio