makenziecham makenziecham

23-10-2020
English

contestada

What is your favorite part of Halloween? If you don’t celebrate Halloween, is there a specific reason? Explain

Respuesta :

ayoung40 ayoung40

23-10-2020

Answer:

CANDYYYYYYYYYYYYYYYYYYYYYYYYYYYY

Explanation:

IT GOOOOOOODODODODODOD

Answer Link

Otras preguntas

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

In your will, you bequeath $6,000,000 into an account that earns 15% annually. The account will fund an annual award in perpetuity that will be given to a world

Convert 3 16 to a decimal using long division. A) 0.1875 B) 0.2 C) 1.875 D) 5.3

Based on what you learned so far, what would you say might influence the function of genes responsible for coat color that leads to the distinctive fur pattern

The height in feet of a bottle rocket in given by h(t)=160t-16t^2 where t is the time in seconds. How long will it take for the rocket to return to ground ? Wha

One type of sunburn occurs on exposure to UV light with a wavelength in the vicinity of 325 nm. What is the energy of a mole of these photons?

In 1991, a U.S. District Court judge ordered ______ to pay $510,000 to a group of eight book publishers for violating their copyrights by producing photocopied

If capital is fixed, but a firm varies labor A. the firm stays on the same isoquant. B. the firm's output will be dependent on the marginal rate of technical

Sweet Cream is an ice cream manufacturer. It sells Guilt-Free, a zero-calorie ice cream, which competes with Flavor Bell's Moo Sweet, a low-calorie ice cream. F

A good change control process will include: a.all of these b.a way to formally document change rejection c.a way to find out the current status of a change u