ernestorobles121106 ernestorobles121106

23-10-2020
Social Studies

contestada

Which of the following geographic features contributed most to the economic development of New York?

Respuesta :

Аноним Аноним

23-10-2020

Answer: Natural harbors provided access to markets only.

Explanation: i hoped that helped.

Answer Link

Otras preguntas

Emily buys 4pens for £1 how much would 7 pens cost ?

Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell

(Does this represent a linear function) (3,6)(0,2)(3,5)

what is 0+50×1-60×0+10=

9. There are many more organisms that use double stranded DNA to carry their genetic information than there are organisms that use single stranded DNA to carry

what do you think accounts for algerias score it has received in recent years on government stability and the absence of violence

Which naval battle forced the German high seas fleet to its harbor and this helped turn the war in favor of the allies

Does old age means end of life according to A Tennyson in Ulysses

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

How do short-term goals differ from long-term goals?