beammyalsab beammyalsab

23-09-2016
Biology

contestada

What will be the effect of putting a plant cell in a hypotonic solution?

Respuesta :

hangingbyathread hangingbyathread

23-09-2016

it will cause the cell to expand by absorbing the water.

Answer Link

Otras preguntas

why were mountain men moving west

if an element has more than one ionic change how is that piece of information represented in the chemical name

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc

What is the color of the stars with the lowest surface temperature

Family values in Ancient Rome included obedience to elders and devotion to the gods

Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?

Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere

The SAT mathematics scores in the state of Florida are approximately normally distributed with a mean of 500 and a standard deviation of 100. Using the empiric

Sharp pain is transmitted through which type of nerve fibers?