mantingz262 mantingz262

25-09-2020
English

contestada

The museums were great.
Identify the complete verb

Respuesta :

Аноним Аноним

25-09-2020

Answer: The verb would be ¨were¨.

Explanation:

Answer Link

Otras preguntas

Explain why 2.15 and -2.15 are are opposites?

statement and reasons m<1 +m<2+ m<3=180 whats the reason?

ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,

1. The chart below shows changes in the length of a tree's shadow during a sunny day. (5.2.D) LENGTH 8:00 AM 2 meters 9:00 A.M. 1 meter 10:00 A.M. 0.5 meter 12:

What are motor proteins? Give 2 examples and describe how they contribute to: 1) directed movement of vesicles in protein transport 2) muscle contraction of ske

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

---------- is the ability to do an activity for more than a few minutes. What is the blank?

Approximately, where do the numbers in the first file go in the second file's number line?If possible, post a number line like mine onto your answer and make ar

what is the most widely held ideal of the us political culture

Dory and Nemo go to Taco Bell for lunch. Dory orders three soft tacos and three double deckers for $11.25. Nemo pays $10.00 for four soft tacos and two Double D