Brandonmunn1986 Brandonmunn1986

21-09-2020
Mathematics

contestada

What two numbers have an estimated sum of 11,000?

Respuesta :

jcherry99 jcherry99

22-09-2020

Answer:

Step-by-step explanation:

If they are the same then the two numbers are 11000 / 2 = 5500

If they are different, then they could be almost anything.

1 + 10999

2 + 10998

5501 + 5499 = 11000

Answer Link

Otras preguntas

Compare and contrast the infection of a bacterial cell by a lytic bacteriophage with the infection of an animal cell by a retrovirus.

Suppose scientists found parts of the DNA from a dinosaur. What info would this discovery provide? What info would it not give them?

what would you call a object that makes people shut up

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What is the answer to 8xsquared-24x

How do bones in a fossil survive for millions of years?

who is the first presiden of United States?

which of the following are examples of ways humans and plants have coevolved? Pick all that apply A. Humans have bred plants to use as food B. Plants provide a

Instructions:Select the correct answer. Read the following excerpt from the poem “On Imagination” by Phillis Wheatley .Imagination! who can sing thy force?Or w

Suppose a pizza must fit into a box with a base that is 12 inches wide. You can use the quadratic function a=(Pi)r^2 to find the area of a pizza in terms of its