biancadan biancadan
  • 24-04-2020
  • Physics
contestada

What does voltage measure?

Respuesta :

jessiciabrown86 jessiciabrown86
  • 03-05-2020

Answer

Voltage measures the potential difference between two points of a circuit.

Explanation:

Answer Link

Otras preguntas

Which non metal is highly reactive
Tony brought 9 2/3pitchers of juice to a volleyball game, and the players drank3 7/8pitchers of it. How much juice is left?
What is the simplest form of ^4sqrt324x^6y^8
Help me please i really need it​
A water tank is filled at a constant rate. After 36 minutes, there are 648 gallons of water in the tank. How many gallons of water flowed into the tank each min
what is equivelent to 4x+(2x+4)?
Janet is playing a game in which she interacts with an environment to solve a puzzle and to meet new characters. She really enjoys this game because there are n
All of the following were colonized by france except.
A carpenter cut three 4ft 6in shelves from a 14ft board. How long a piece was left over?.
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):