addyd2004 addyd2004

23-04-2020
Mathematics

contestada

Find the sum of (63−4)+(−23+9)=

Respuesta :

lillyfyobrien lillyfyobrien

23-04-2020

Answer:

45

Step-by-step explanation

Hope this helps :)

Answer Link

Quikong321 Quikong321

23-04-2020

Answer:

45

Step-by-step explanation:

(63-4) + (-23+9) = ?

v v

59 + -14 = ?

45

Answer Link

Otras preguntas

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair

Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Is sextillion a real number?

1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.

what are the best study tips for Sol or finals

how could you use division to find out how many whole pies are in 11/3 of a pie? explain!!!!!!

Explain how the delay in marching through Belgium helped France to Survive.

Desert animals need to concentrate urine. What structural changes in the kidney would be associated with a kidney that is exceptionally good at concentrating ur