luvxmimi luvxmimi

23-04-2020
Biology

contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC

Respuesta :

Аноним Аноним

23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link

StephanyNo StephanyNo

23-04-2020

AUGGGUAAUGCGCCGUUCGCAUUAAUG

Answer Link

Otras preguntas

Should Ads be Banned from TV Programs?Im writing to complain abut ads on TV. There are so many ads, especially during my favorite programs. I think they should

What are the two main things that make up the solids in paint?a. Pigmentsb. Bindersc. Solventsd. Additives

Repond a l’exercice 4 s’il te plait

How does this value compared to the energy released in the proton-proton chain?

A freezer is used to freeze 2.8 L of water completely into ice. The water and the freezer remain at a constant temperature of T = 0°C. a) True b) False

What type of military authority includes the responsibility to organize, direct, coordinate, employ, and control military forces?

A serving of filleted fish is generally concidered to be about 1/4lb. how many servings can be prepared from 7 1/2lb of fillets ?

When we introduce a non-native herbivore to replace an extinct herbivore that once served as a mutualist, what factors are likely to be important in determining

Jane was sent by her Chicago-based company to a business convention in Tokyo, Japan. While at lunch, she and several other Americans in attendance sat together

Describe the effect of herbivore browsing on the phenotype of Acacia trees.