Adriansanchez05 Adriansanchez05

25-03-2020
Mathematics

contestada

Combine like terms.
2x^2+7+6x-1-7x-6x^2+1
2x
2
+7+6x−1−7x−6x
2
+1

Respuesta :

Blinkkie Blinkkie

25-03-2020

Here is a picture of the answer:

Ver imagen Blinkkie

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The inferior hypogastric plexus is the site of synapse between sympathetic preganglionic and postganglionic neurons for: a. Part of the foregut b. All of the fo

Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18

Each of the mutants listed below this paragraph has a different mutant form of the gene encoding protein X. Each mutant gene contains one or more nucleotide ins

what procedure could you use to test the effect of a catalyst on a reaction

in dogs, wire hair (S) is dominant to smooth (s). Cross of a homozygous wire-haired dog with a smooth-haired dog and show the genotypic and phenotypic ratios.

Compare and contrast immune tolerance with licensing

What makes for good scientific data

1) A fashion designer makes and sells hats. The material for each hat costs $5.50. The hats sell for $12.50 each. The designer spends $1400 on advertising. How

find the amount of the discount on a $234 item with a discount of 15% A. $35.01 B. $40.00 C. $23.40 D. $35.10