aspenpottorff7 aspenpottorff7

22-01-2020
Mathematics

contestada

Li’s garden is shaped like a rectangle. The area of the garden is 232 meters. If the length is 8 meters, what is the perimeter?
16 m
29 m
58 m
74 m

Respuesta :

desthermitcrab desthermitcrab

22-01-2020

Answer: 29 m

Step-by-step explanation: First find the width

Since Area = Length x Width

Width = Area/Length = 232/8 = 29

Please mark as the brainliest! Thanks!

Answer Link

Otras preguntas

how many atoms are present in 4.0 mol of sodium

What might "tangible artifacts" tell us about the Shang?

What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite

A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea

7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da

what are the 3 care instructions for future life on earth

Consider the following piecewise-defined function. f(x){x^2 -5, x<3

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

A common way to deliver anesthesia for surgery and childbirth is to inject the anesthetic agent into the epidural space. A possible complication of this procedu

Which muscle below is a 2nd class lever? A) Gastrocnemius B) Biceps Brachii C) Flexor carpi ulnaris D) Extensor carpi ulnaris