24-08-2019
Biology

contestada

Based on the illustration, what happens to most of the mass gained by the plant cell through photosynthesis?

Respuesta :

Annaking95 Annaking95

25-08-2019

Answer:well is lost through heat through the process of metabolism

Explanation:

Answer Link

Otras preguntas

1+4=5 2+5=12 3+6=21 8+11=?

How many times dose 63 go into 359

Which of the following can increase your credit cards APR

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Explain the importance of spore formation for both eukaryotes and prokaryotes.

What molecule is responsible for determining the fate of each cell

15% of 6758 for fun. lets see if you can answer this

What the the equation -984-n=-285 what does n equal

what stress force on a reverse fault?

How are glial cells and neurons alike and how are they different. Give 3 sentences for each