aabcunasovf076 aabcunasovf076
  • 22-05-2019
  • Mathematics
contestada

Suppose P(C|D) = 0.26, P(D) = 0.22, and P(D|C) = 0.17. What is P(C) rounded to the nearest two decimal places?

Respuesta :

Kittygirl11
Kittygirl11 Kittygirl11
  • 22-05-2019

Suppose P(C | D) = 0.26, P(D) = 0.22, and P(D | C) = 0.17. What is P(C) Rounded to two decimal places?  

A. 0.42

B. 0.34

C. 0.57

D. 0.68

the underlined number would be the answer.

Answer Link

Otras preguntas

i need help with this
14. Convert 63% to a fraction
The equation for the reaction is: C6H8O7 + 3 NaOH - C6H5O7Na3 + 3 H₂O The concentration of the sodium hydroxide was 0.102 mol/dm³ Concordant results are those
Name one of the two types of software used by a computer.
what is the slope of the line
Find the highest common factor (HCF) of 90​
Soshabsbxbcjcjdjnenen
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Write two or more paragraphs answering the question below. Include quotations/examples from the Unit 1 readings to support your statements. Question: In Unit 1
Sue has 20 biscuits in a tin. There are: 12 plain biscuits 5 chocolate biscuits 3 currant biscuits Sue takes at random two biscuits from the tin. Work out the p