sarah1965 sarah1965

24-03-2019
Mathematics

contestada

18+s=33 I'm not sure what the answer is to this

Respuesta :

MsHamel MsHamel

24-03-2019

Answer:

15

Step-by-step explanation:

1. Subtract 18 from both sides to isolate S

18+S-18 = 33-18

2. S = 15

To check - insert 15 for S

18+15=33

Answer Link

Otras preguntas

what is a theme of a Harlem [2]

At an ice cream shop, 4 of the last 10 cones sold had cookies and cream ice cream. Considering this data, how many of the next 15 cones sold would you expect to

How is Louis XVI, absolutism, and versailles place related? some pls answer fast!!

please hurry and answer

What is the demand factor for three commercial ranges?

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA

Los paralelos también permiten diferenciar las zonas climáticas de la tierra llamadas zonas de latitud.

Who said this? "This morning, I was lookin' in the mirror and thinking about it...I'm thirty five years old; I been married eleven years and I got a boy who sle

Air becomes wind as it flows from a. low pressure to low pressure. c. low pressure to high pressure. b. high pressure to high pressure. d. high pressure to low

Is art and science different or the same? Explain.