24-01-2019
Social Studies

contestada

What kind of map is this?
a.
topographical map

b.
political map

c.
weather map

d.
regional map

What kind of map is this a topographical map b political map c weather map d regional map class=

Respuesta :

gracemitchell gracemitchell

24-01-2019

it is c, a weather map

Answer Link

zainabdukureh2 zainabdukureh2

17-09-2019

Answer:

it's c. weather map

Answer Link

Otras preguntas

History- why was it easy for England to take control of New Amsterdam?

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Substance B is found to be more viscous than substance A. This means that _____. B flows faster at room temperature than A does B flows slower at room temperatu

after an initial period of exponential growth, a population will encounter a ___ that will cause the ecponential growth to stop

what are stars and galaxy made of?

Read the following prompt and type your answer in the space provided.Consider a 1000 year old forest and a 30 year old tree farm how do the differences between

The fireworks that were produced year-round in south africa were sent to warehouses around the united states during the months of may and june in anticipation

Are air temperatures over land always higher than the air temperatures over the ocean

What was a result of the kansas city gun experiment? gun crimes were displaced to contiguous beats. gun crimes in the target area marginally increased. there wa

The Okinawa and Amami Great Island are the biggest among the Ryukyu Islands. How were these bigger islands created?