mari465 mari465

25-09-2018
Mathematics

contestada

which term best describes the lines that intersect at a 90 angle

Respuesta :

superjack1103 superjack1103

25-09-2018

if is a 90 degree angle it would a right angle

Answer Link

Otras preguntas

what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

find the quotient of 3870 and 18

what would you use chromatography for?

Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.

which one of the statements is true

Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ