Jackson120101 Jackson120101

21-05-2018
Chemistry

contestada

An acid dissolved in water increases the concentration of

Respuesta :

Diatonic254 Diatonic254

24-04-2019

Answer:

H+

Explanation:

AH + H2O --- A- + H+

Weak acids dissociate partially in the water while strong acids dissociate fully. The pH of the solution will be determined by the number of H+ ions (protons) in the water. The pH is determined by; pH = -log[H+]

Answer Link

Otras preguntas

heeeelllpppppp!!!!!!!!

businss essay format

Question of What is one example of the government using fiscal policy to manage the economy A. Lowering taxes to help businesses make a profit B. Lowering inter

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

please HELP ME AHHH need help

Can someone help me please? ASAP

Which of the following does not correctly show an ion dipole interaction

Match each vocabulary word with the word that has the most similar meaning

fuse Check all correct elements below that you included in your question. format: "What is the effect of X on Y?" independent variable: molecule size dependent

What would you expect the difference to be in the rate of diffusion of vinegar (molecular weight about 60) compared to oxygen (molecular weight about 32)?