goeagles goeagles

21-05-2018
Social Studies

contestada

When Lincoln finally sent supplies to Fort Sumter, he used
unarmed ships ios the answer

Respuesta :

colebbb18 colebbb18

06-03-2019

heavily armed ships

Answer Link

giannavento10 giannavento10

02-04-2021

Answer:

A.

Explanation:

Answer Link

Otras preguntas

in a beauty contest, half of the judges voted for miss.a .2\3 of them voted for miss.b., 10 voted for both and 6 did not vote for either miss.a or miss.b.find h

why does a virus stay in a person for life, such as hepatitis

What the the equation -984-n=-285 what does n equal

Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?

Helpp Pleasee ASAPPPPP

plz help what is the answer.

Who owned the land that is now Florida before it became part of the United States? A. France B. Great Britain C. Spain D. Mexico

Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Question 16 of 20 Select the best answer for the question. 16. Which of these federal policing agencies is part of the U.S. Department of the Treasury?