kayleee7761 kayleee7761

24-04-2024
Social Studies

contestada

According to the _______ view, what matters most is individual freedom and a person's right to direct their own life for themselves.
a) libertarian
b) communitarian
c) Kantian
d) prudential

Respuesta :

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What is the Rub' al Khali? an area of fertile land in the central Arabian Peninsula a river in the northern Arabian Peninsula a forest in the southwestern Arabi

If you drink a soda with sugar, what happens to your blood glucagon levels?

A population consists of 300 individuals where 58 of them are homozygous for the red color allele (A) and 120 of them are homozygous for the blue color allele (

only question 4 thank you

The answer to 5+5×5+5=

what percent of 137.4 is 96

Can anyone to correct it if necessary? Thank you.

Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.

Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?