Scorpionhigh24 Scorpionhigh24

22-04-2024
Mathematics

contestada

In making macaroni and cheese, Samantha used 1/2 of a cup of cheddar and 1/3 of a cup of parmesan. How much cheese did Samantha use in all?

Respuesta :

Otras preguntas

in your analysis of a new bacterial species, you gram stained the bacteria and observed them under the microscope. the bacteria appear to have a round shape and

which of these countries has an economy most similar to that of the former soviet union? multiple choice question. a) sweden b) norway c) south korea d) north k

while speaking with a co-worker concerning a surprise party on a standard phone, you hear a faint click. later, another co-worker makes a statement that implies

Given an array of integers nums and an integer target, return indices of the two numbers such that they add up to target. You may assume that each input would h

W i directly proportional to the cube root of X X i increaed by 50% Work out percentage increae in W

consider a snooping-based shared memory system performing the following memory related operations. please indicate the value of the memory location y, and the c

A 600-kilogram space vehicle travels at 4. 8 meters per second along the level surface of mars. If the magnitude of the gravitational field strength on the surf

find an antiderivative of f(x) = tan−1x satisfying f(0) = 1.

The curved rod has a radius of 5 ft. If a force of 60 lb acts at its end as shown, determine the moment of this force about point C.

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?