DalyFlores72891 DalyFlores72891
  • 22-04-2024
  • Business
contestada

Which of the following is not one of the primary strategy options for establishing a competitive presence in the markets of foreign countries?
A) Exporting
B) Licensing
C) Franchising
D) Outsourcing

Respuesta :

Otras preguntas

College students are to be offered year-long
Kyle works at a donut​ factory, where a​ 10-oz cup of coffee costs 95¢​, a​ 14-oz cup costs​ $1.15, and a​ 20-oz cup costs​ $1.50. During one busy​ period, Kyle
PLEASE HELP!!!! ITS URGENT IM BEGGING HELP
Alternative measures of the price level aim to improve on the CPI. Which of the following statements is​ true? A. The CPI and the​ C-CPI can be used to measure
(m+n)^2 - (m-n)^2 = 16 then mn is​
15% of £34 how much is 15% out of £34
What is the central nervous system made up of?
please help me u guys!!
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
A laminated steel ring is wound with 3000 turns. When the magnetism current varies between 7 and 9 A, the magnetic flux varies between 860 and 900Nwb, calculate