cutebab9820 cutebab9820
  • 25-03-2024
  • Business
contestada

Suppose that entry into this industry changes this firm's demand schedule from columns (1) and (3) to columns (2) and (3). We can conclude that this industry is ________.

Respuesta :

Otras preguntas

If y= 4x +5 has a gradient of 4 write the equation of a line parrellel to it?
Please help me answer these questions
how to solve these questions?
What domain did sues rule?
Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron
what the decimal of 2 1/4
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What is the vapor pressure of water at 750C?
why were mountain men moving west
If 1+4=5; 2+5=12; 3+6==21; what is 8+11