malloryroadruck4376 malloryroadruck4376

25-02-2024
Mathematics

contestada

If the 10th term of an ap is 1/20 and its 20th term is 1/10 then the sum of the first 200 terms is
a. 100(1/2)
b. 50
c. 50(1/4)
d. 100

Respuesta :

Otras preguntas

How many atoms of oxygen are in one formula unit of Al2(SO4)3? 4 6 7 12 What is the name of the compound Cr2(CO3)3? Which of the following contains both io

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

The equation for density is mass divivded by volume.an increase in denstiy can result from all of following expect??

Is The Paradise of the Ostrich By Samuel Church à reliable resource?

Which revision fixes the mistake in parallel structure in this sentence? Marisol likes watching sports more than she likes to play them. A.) Marisol likes to

Which of the following statements about irrational numbers is FALSE? A. Irrational numbers have no repeating decimals. B. is an irrational number. C. If a

mr.brooks was working on addition using dominos with a group of 1st graders. when picking the domino with 3 dots on one end and 5 dots on the other, some studen

Es posible bajar en el ascensor o en la escalera.

In terms of osmoregulation, freshwater fish __________. must drink a lot of water and excrete excess salts must have dilute urine and consume salt in their diet

Solve for x. 5/7x+1/7=63 Enter your answer in the box.